custom-built matlab script version 2019b Search Results


90
MathWorks Inc custom-built matlab script version 2019b
Custom Built Matlab Script Version 2019b, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/custom-built matlab script version 2019b/product/MathWorks Inc
Average 90 stars, based on 1 article reviews
custom-built matlab script version 2019b - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Kongsberg Maritime Contros GmbH em2040 wcd amplitudes
Em2040 Wcd Amplitudes, supplied by Kongsberg Maritime Contros GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/em2040 wcd amplitudes/product/Kongsberg Maritime Contros GmbH
Average 90 stars, based on 1 article reviews
em2040 wcd amplitudes - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
MathWorks Inc computational pipeline matlab 2019b
(A) Schematics summarizing the in situ electro-seq method. (B) Representative photograph of flexible mesh electronics. Inset: schematic illustrates the multilayer structure of the electronics. (C) Overlapped fluorescence and bright-field (BF) image of a pair of binary E-barcodes highlighted in red box in (B). (D) Electrochemical impedance and phase from 0.1 to 10 kHz of a representative electrode. (E-F) Electrochemical impedance at 1 kHz across five different samples (E) and over two months of incubation (F). Values are mean ± SEM. (G) In situ <t>sequencing</t> of cell-electronics hybrid (See STAR Methods). (H) Representative images of five rounds of sequencing overlayed with E-barcode. X, unknown base; red underline, decoded sequence; Ch1 to Ch4, fluorescence channels; E-barcodes labeled with R6G.
Computational Pipeline Matlab 2019b, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/computational pipeline matlab 2019b/product/MathWorks Inc
Average 90 stars, based on 1 article reviews
computational pipeline matlab 2019b - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
MathWorks Inc built-in statistical functions
(A) Schematics summarizing the in situ electro-seq method. (B) Representative photograph of flexible mesh electronics. Inset: schematic illustrates the multilayer structure of the electronics. (C) Overlapped fluorescence and bright-field (BF) image of a pair of binary E-barcodes highlighted in red box in (B). (D) Electrochemical impedance and phase from 0.1 to 10 kHz of a representative electrode. (E-F) Electrochemical impedance at 1 kHz across five different samples (E) and over two months of incubation (F). Values are mean ± SEM. (G) In situ <t>sequencing</t> of cell-electronics hybrid (See STAR Methods). (H) Representative images of five rounds of sequencing overlayed with E-barcode. X, unknown base; red underline, decoded sequence; Ch1 to Ch4, fluorescence channels; E-barcodes labeled with R6G.
Built In Statistical Functions, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/built-in statistical functions/product/MathWorks Inc
Average 90 stars, based on 1 article reviews
built-in statistical functions - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
MathWorks Inc customized semi-automated tortuosity software
(A) Schematics summarizing the in situ electro-seq method. (B) Representative photograph of flexible mesh electronics. Inset: schematic illustrates the multilayer structure of the electronics. (C) Overlapped fluorescence and bright-field (BF) image of a pair of binary E-barcodes highlighted in red box in (B). (D) Electrochemical impedance and phase from 0.1 to 10 kHz of a representative electrode. (E-F) Electrochemical impedance at 1 kHz across five different samples (E) and over two months of incubation (F). Values are mean ± SEM. (G) In situ <t>sequencing</t> of cell-electronics hybrid (See STAR Methods). (H) Representative images of five rounds of sequencing overlayed with E-barcode. X, unknown base; red underline, decoded sequence; Ch1 to Ch4, fluorescence channels; E-barcodes labeled with R6G.
Customized Semi Automated Tortuosity Software, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/customized semi-automated tortuosity software/product/MathWorks Inc
Average 90 stars, based on 1 article reviews
customized semi-automated tortuosity software - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Thermo Fisher a32723
Key Resource Table
A32723, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/a32723/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
a32723 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


(A) Schematics summarizing the in situ electro-seq method. (B) Representative photograph of flexible mesh electronics. Inset: schematic illustrates the multilayer structure of the electronics. (C) Overlapped fluorescence and bright-field (BF) image of a pair of binary E-barcodes highlighted in red box in (B). (D) Electrochemical impedance and phase from 0.1 to 10 kHz of a representative electrode. (E-F) Electrochemical impedance at 1 kHz across five different samples (E) and over two months of incubation (F). Values are mean ± SEM. (G) In situ sequencing of cell-electronics hybrid (See STAR Methods). (H) Representative images of five rounds of sequencing overlayed with E-barcode. X, unknown base; red underline, decoded sequence; Ch1 to Ch4, fluorescence channels; E-barcodes labeled with R6G.

Journal: Cell

Article Title: Multimodal charting of molecular and functional cell states via in situ electro-sequencing

doi: 10.1016/j.cell.2023.03.023

Figure Lengend Snippet: (A) Schematics summarizing the in situ electro-seq method. (B) Representative photograph of flexible mesh electronics. Inset: schematic illustrates the multilayer structure of the electronics. (C) Overlapped fluorescence and bright-field (BF) image of a pair of binary E-barcodes highlighted in red box in (B). (D) Electrochemical impedance and phase from 0.1 to 10 kHz of a representative electrode. (E-F) Electrochemical impedance at 1 kHz across five different samples (E) and over two months of incubation (F). Values are mean ± SEM. (G) In situ sequencing of cell-electronics hybrid (See STAR Methods). (H) Representative images of five rounds of sequencing overlayed with E-barcode. X, unknown base; red underline, decoded sequence; Ch1 to Ch4, fluorescence channels; E-barcodes labeled with R6G.

Article Snippet: A customized computational pipeline was built with MATLAB (2019b) to decode gene identity and quantify the gene expression level of each cell from the in situ sequencing images.

Techniques: In Situ, Fluorescence, Incubation, Sequencing, Labeling

KEY RESOURCES TABLE

Journal: Cell

Article Title: Multimodal charting of molecular and functional cell states via in situ electro-sequencing

doi: 10.1016/j.cell.2023.03.023

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: A customized computational pipeline was built with MATLAB (2019b) to decode gene identity and quantify the gene expression level of each cell from the in situ sequencing images.

Techniques: Recombinant, Microscopy, In Situ, Sequencing, Software

Key Resource Table

Journal: Cell systems

Article Title: Inferring leading interactions in the p53/Mdm2/Mdmx circuit through live-cell imaging and modeling

doi: 10.1016/j.cels.2019.10.010

Figure Lengend Snippet: Key Resource Table

Article Snippet: ​ table ft1 table-wrap mode="anchored" t5 caption a7 REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mdm2 (SMP 14 ) Santa Cruz Cat. No. sc-965 P53 (FL-393) Santa Cruz Cat. No. sc-6243 Goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor Plus 488 ThermoFisher Scientific Cat. No. A32723 Donkey anti-Rabbit IgG (H+L) Highly Cross-Ad-sorbed Secondary Antibody, Alexa Fluor Plus 647 ThermoFisher Scientific Cat. No. A32795 DharmaFect I Dharmacon Cat. No. T-2001 Chemicals DAPI Sigma D9542 DABCO 33-LV Sigma Cat. No. 290734 Experimental Models: Cell Lines MCF7+p53shRNA+p53-mCerulean ( Gaglia et al., 2013 ) N/A Oligonucleotides MDMX siRNA: AGCCCTCTCTATGATATGCTA Qiagen Cat. No. 1027417 MDMX siRNA: GACCACGAGACGGGAACATTA Qiagen Cat. No. 1027417 AllStars Negative Control siRNA Qiagen Cat. No. 1027280 Software and Algorithms MATLAB 2019b The MathWorks, Inc. https://www.math-works.com P53 Cinema Single Cell Tracking Software ( Reyes et al., 2018 ) https://github.com/balvahal/p53Cine-maManual Custom Matlab script- model This work https://github.com/Mathiasheltberg/In-teractionsP53Net-work Open in a separate window Key Resource Table Impact factors in systems biology - Using models to rule out and validate hypotheses Mathematical models are routinely built to represent known biological interactions and recapitulate the behaviors they generate.

Techniques: Negative Control, Software, Single Cell Tracking